ID: 1083033492_1083033502

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1083033492 1083033502
Species Human (GRCh38) Human (GRCh38)
Location 11:59615499-59615521 11:59615522-59615544
Sequence CCGCCGCCGCCGCGACCACCGTC CCTGACGCGGCCCCGGAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 16, 3: 270, 4: 2128} {0: 1, 1: 0, 2: 0, 3: 14, 4: 193}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!