ID: 1083047998_1083048011

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1083047998 1083048011
Species Human (GRCh38) Human (GRCh38)
Location 11:59754048-59754070 11:59754066-59754088
Sequence CCCCCAAACTCCCCAAAAATGTG ATGTGTTAGGGGAAGGAGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 248} {0: 1, 1: 0, 2: 3, 3: 43, 4: 468}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!