ID: 1083048275_1083048290

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1083048275 1083048290
Species Human (GRCh38) Human (GRCh38)
Location 11:59755469-59755491 11:59755505-59755527
Sequence CCCGCCGCCGCCTGCGCCTCCAG GCGGGCCCGGCCGCCGCTTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 16, 3: 66, 4: 587} {0: 1, 1: 0, 2: 1, 3: 19, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!