ID: 1083050051_1083050054

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1083050051 1083050054
Species Human (GRCh38) Human (GRCh38)
Location 11:59769041-59769063 11:59769081-59769103
Sequence CCTGCACACATGTATTGGGAAAC TTTATCCAATCATCCATTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 101} {0: 39, 1: 413, 2: 1734, 3: 6680, 4: 16843}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!