ID: 1083063557_1083063564

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1083063557 1083063564
Species Human (GRCh38) Human (GRCh38)
Location 11:59899595-59899617 11:59899633-59899655
Sequence CCTGGGTGCAGACGGGCTGAGGC CCCTAAGTGAAGACGGGGCAGGG
Strand - +
Off-target summary {0: 12, 1: 50, 2: 1036, 3: 1417, 4: 674} {0: 1, 1: 0, 2: 4, 3: 22, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!