ID: 1083083215_1083083219

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1083083215 1083083219
Species Human (GRCh38) Human (GRCh38)
Location 11:60114711-60114733 11:60114739-60114761
Sequence CCCAGGGGCAGCATGCAGGACCA TCTGAAAAAAAATGCATTAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 52, 4: 486}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!