ID: 1083100277_1083100280

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1083100277 1083100280
Species Human (GRCh38) Human (GRCh38)
Location 11:60297576-60297598 11:60297625-60297647
Sequence CCAGAATGGCTTAAACATTGGAA GTGGCTTATCATTTCTAGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 187} {0: 1, 1: 0, 2: 2, 3: 107, 4: 201}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!