ID: 1083104466_1083104472

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1083104466 1083104472
Species Human (GRCh38) Human (GRCh38)
Location 11:60344781-60344803 11:60344830-60344852
Sequence CCTATTTCCTTCAGCTACTTCAT TGTAGCACTGTTATCTTTCATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 13, 3: 49, 4: 377} {0: 1, 1: 0, 2: 0, 3: 15, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!