ID: 1083104682_1083104684

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1083104682 1083104684
Species Human (GRCh38) Human (GRCh38)
Location 11:60346416-60346438 11:60346430-60346452
Sequence CCTATCACCTGCTGCTGTAGTTT CTGTAGTTTCCTCTTAATGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 196} {0: 1, 1: 0, 2: 3, 3: 28, 4: 214}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!