ID: 1083119856_1083119862

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1083119856 1083119862
Species Human (GRCh38) Human (GRCh38)
Location 11:60500898-60500920 11:60500948-60500970
Sequence CCCACCTCCTGCTTCAGATGTGT AAAATTGACAATAAATAAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 245} {0: 1, 1: 0, 2: 7, 3: 87, 4: 1766}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!