|
Left Crispr |
Right Crispr |
| Crispr ID |
1083121820 |
1083121824 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:60520678-60520700
|
11:60520705-60520727
|
| Sequence |
CCCTGATCTGGCTGTTTTCACAG |
GCGTTGTCTGCAGCTTTTCCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 1, 2: 1, 3: 35, 4: 320} |
{0: 2, 1: 7, 2: 41, 3: 103, 4: 919} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|