ID: 1083140118_1083140130

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1083140118 1083140130
Species Human (GRCh38) Human (GRCh38)
Location 11:60714740-60714762 11:60714789-60714811
Sequence CCCTCAGGTCTCCACACCCAAAG ATGGTCATCTTTTTTCTCAGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 16, 4: 236} {0: 1, 1: 0, 2: 5, 3: 25, 4: 273}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!