ID: 1083154219_1083154226

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1083154219 1083154226
Species Human (GRCh38) Human (GRCh38)
Location 11:60812704-60812726 11:60812749-60812771
Sequence CCCTGGCTGAAAAAAAGGAGAGG CATCATCCACCTCCAGTCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 56, 4: 553} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!