ID: 1083159318_1083159324

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1083159318 1083159324
Species Human (GRCh38) Human (GRCh38)
Location 11:60845046-60845068 11:60845079-60845101
Sequence CCACAGTGCTCAGAGATGGCCTT AGGTCTGAGCAGAGGGAGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 25, 4: 318} {0: 1, 1: 0, 2: 9, 3: 60, 4: 483}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!