ID: 1083159911_1083159926

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1083159911 1083159926
Species Human (GRCh38) Human (GRCh38)
Location 11:60848509-60848531 11:60848553-60848575
Sequence CCCCGCACCTTTCCTCCACTTCT AGCCAGGAAGCCCCTGTAAAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 28, 4: 434} {0: 1, 1: 0, 2: 1, 3: 16, 4: 195}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!