ID: 1083173288_1083173295

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1083173288 1083173295
Species Human (GRCh38) Human (GRCh38)
Location 11:60935163-60935185 11:60935182-60935204
Sequence CCGTGAGGGTGCTGGGAGCACCC ACCCGGTTCCCTCTGGGTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 268} {0: 2, 1: 0, 2: 1, 3: 8, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!