ID: 1083173829_1083173837

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1083173829 1083173837
Species Human (GRCh38) Human (GRCh38)
Location 11:60937414-60937436 11:60937438-60937460
Sequence CCTCTGTCTTGCGCCCTGTGCCT CCGTGTCCTAGCCCTGGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 616} {0: 1, 1: 0, 2: 1, 3: 21, 4: 202}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!