ID: 1083190982_1083190990

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1083190982 1083190990
Species Human (GRCh38) Human (GRCh38)
Location 11:61052399-61052421 11:61052438-61052460
Sequence CCCAGGGAGCTTTCCCTTCTCTT TACTTAGCAGGTACGAGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 39, 4: 292} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!