ID: 1083201189_1083201190

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1083201189 1083201190
Species Human (GRCh38) Human (GRCh38)
Location 11:61121992-61122014 11:61122009-61122031
Sequence CCTGGGGAGCTAGACAGAGAGTC AGAGTCCCAGAGACCCAGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 218} {0: 1, 1: 0, 2: 4, 3: 48, 4: 437}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!