ID: 1083207339_1083207345

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1083207339 1083207345
Species Human (GRCh38) Human (GRCh38)
Location 11:61160762-61160784 11:61160796-61160818
Sequence CCAGGCATATAATGGGTATGTAT CTTTGCGCCCAGAGGGTCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 204} {0: 1, 1: 0, 2: 0, 3: 13, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!