ID: 1083220060_1083220067

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1083220060 1083220067
Species Human (GRCh38) Human (GRCh38)
Location 11:61246434-61246456 11:61246458-61246480
Sequence CCCTTGGCCCCCAAAGATACCAT TAAAGTGAATACAGTTAGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 134} {0: 1, 1: 0, 2: 2, 3: 20, 4: 286}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!