ID: 1083220122_1083220124

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1083220122 1083220124
Species Human (GRCh38) Human (GRCh38)
Location 11:61247009-61247031 11:61247036-61247058
Sequence CCAAATGTCAGTTTGGGCTGAGT TGTTATGCAAGAATACCTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 107} {0: 1, 1: 0, 2: 2, 3: 18, 4: 206}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!