ID: 1083251671_1083251684

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1083251671 1083251684
Species Human (GRCh38) Human (GRCh38)
Location 11:61472092-61472114 11:61472118-61472140
Sequence CCTGCTTCTCCCTTCCCACCCCC CCATACACAAAGGTGGAGTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 14, 3: 233, 4: 1944} {0: 1, 1: 0, 2: 0, 3: 9, 4: 111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!