ID: 1083251673_1083251684

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1083251673 1083251684
Species Human (GRCh38) Human (GRCh38)
Location 11:61472102-61472124 11:61472118-61472140
Sequence CCTTCCCACCCCCACGCCATACA CCATACACAAAGGTGGAGTAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 7, 3: 70, 4: 619} {0: 1, 1: 0, 2: 0, 3: 9, 4: 111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!