ID: 1083252475_1083252476

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1083252475 1083252476
Species Human (GRCh38) Human (GRCh38)
Location 11:61477358-61477380 11:61477384-61477406
Sequence CCTCACATGTAACATGGGCAGGA TAGTAGTTCCCACGTAGAGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 313} {0: 1, 1: 0, 2: 0, 3: 2, 4: 32}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!