ID: 1083252622_1083252627

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1083252622 1083252627
Species Human (GRCh38) Human (GRCh38)
Location 11:61478039-61478061 11:61478059-61478081
Sequence CCCTCCACCTGCTAAAAGGAAAA AAACCTGGCTACAGCCTACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 427} {0: 1, 1: 0, 2: 0, 3: 10, 4: 109}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!