ID: 1083267868_1083267887

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1083267868 1083267887
Species Human (GRCh38) Human (GRCh38)
Location 11:61555287-61555309 11:61555326-61555348
Sequence CCCCGGGCCCACCGTCGCCCCCC CCAAAGTCCCACCACACTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 314} {0: 1, 1: 0, 2: 1, 3: 10, 4: 148}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!