ID: 1083270730_1083270735

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1083270730 1083270735
Species Human (GRCh38) Human (GRCh38)
Location 11:61571201-61571223 11:61571226-61571248
Sequence CCCATGTGCCTCTGCACAGACAC CTACCATCGTGTTTCCACATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 249} {0: 1, 1: 0, 2: 0, 3: 1, 4: 60}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!