ID: 1083271378_1083271386

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1083271378 1083271386
Species Human (GRCh38) Human (GRCh38)
Location 11:61574616-61574638 11:61574637-61574659
Sequence CCCATCCTTGGATGGGGGTCAGG GGGATGGTAAGGAGGTGTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 16, 4: 162} {0: 1, 1: 0, 2: 0, 3: 25, 4: 290}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!