ID: 1083293701_1083293706

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1083293701 1083293706
Species Human (GRCh38) Human (GRCh38)
Location 11:61703884-61703906 11:61703905-61703927
Sequence CCAGGGAAACTCCATTTTTATGC GCTTAAGTTTGAGGAGGAATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 225} {0: 1, 1: 0, 2: 2, 3: 18, 4: 226}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!