ID: 1083300741_1083300748

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1083300741 1083300748
Species Human (GRCh38) Human (GRCh38)
Location 11:61738574-61738596 11:61738590-61738612
Sequence CCGAAGCCTCTGAGATTCCCTAG TCCCTAGGCTCAGGGAGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 212} {0: 1, 1: 0, 2: 1, 3: 33, 4: 345}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!