ID: 1083316466_1083316469

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1083316466 1083316469
Species Human (GRCh38) Human (GRCh38)
Location 11:61817384-61817406 11:61817411-61817433
Sequence CCCTTGAAAGTTGCAGTTATCTT ACAGCATATTTACGGTCTCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 237} {0: 1, 1: 0, 2: 1, 3: 6, 4: 79}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!