ID: 1083316466_1083316479

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1083316466 1083316479
Species Human (GRCh38) Human (GRCh38)
Location 11:61817384-61817406 11:61817434-61817456
Sequence CCCTTGAAAGTTGCAGTTATCTT GCTTGGTGGTGGTTGGGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 237} {0: 1, 1: 0, 2: 9, 3: 102, 4: 1059}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!