ID: 1083327119_1083327137

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1083327119 1083327137
Species Human (GRCh38) Human (GRCh38)
Location 11:61878492-61878514 11:61878540-61878562
Sequence CCACGTCCCTCCCCACCCACCTC ACGGGCGCCACCGTCACGTCTGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 15, 3: 179, 4: 2050} {0: 1, 1: 0, 2: 0, 3: 3, 4: 55}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!