ID: 1083331911_1083331920

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1083331911 1083331920
Species Human (GRCh38) Human (GRCh38)
Location 11:61902660-61902682 11:61902682-61902704
Sequence CCCCCACCCGGCTTCCAAAGGAA ACCCAGAGCCAGGCAGAGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 186} {0: 1, 1: 0, 2: 5, 3: 79, 4: 657}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!