ID: 1083332831_1083332845

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1083332831 1083332845
Species Human (GRCh38) Human (GRCh38)
Location 11:61906955-61906977 11:61906998-61907020
Sequence CCCATGAGAGTTCTGGGACCGCC CAGGCCTCACATTTTGCAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 61} {0: 1, 1: 0, 2: 4, 3: 39, 4: 238}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!