ID: 1083332842_1083332846

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1083332842 1083332846
Species Human (GRCh38) Human (GRCh38)
Location 11:61906986-61907008 11:61906999-61907021
Sequence CCAGGAAAGGCCCAGGCCTCACA AGGCCTCACATTTTGCAGATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 262} {0: 1, 1: 0, 2: 5, 3: 24, 4: 223}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!