ID: 1083334391_1083334397

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1083334391 1083334397
Species Human (GRCh38) Human (GRCh38)
Location 11:61914268-61914290 11:61914287-61914309
Sequence CCCAACCCCTGGGAGGTTGGAGT GAGTGGTCTCATCTCATTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 240} {0: 1, 1: 0, 2: 2, 3: 12, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!