ID: 1083367535_1083367547

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1083367535 1083367547
Species Human (GRCh38) Human (GRCh38)
Location 11:62150527-62150549 11:62150574-62150596
Sequence CCAGCAGGGCTGAAGAGACTTGG AGGCAGAGCTAGAATGGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 173} {0: 1, 1: 0, 2: 0, 3: 43, 4: 482}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!