ID: 1083372111_1083372119

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1083372111 1083372119
Species Human (GRCh38) Human (GRCh38)
Location 11:62190367-62190389 11:62190403-62190425
Sequence CCAGCCCTTGGGACACACCCTTC TCACCTATTAAGGTTAAGGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 462} {0: 1, 1: 0, 2: 0, 3: 6, 4: 81}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!