ID: 1083421556_1083421561

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1083421556 1083421561
Species Human (GRCh38) Human (GRCh38)
Location 11:62556182-62556204 11:62556196-62556218
Sequence CCTCACCCCAGTCTCTGTGCCAT CTGTGCCATGTGCTGGACCATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 77, 4: 460} {0: 1, 1: 0, 2: 2, 3: 27, 4: 257}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!