ID: 1083425246_1083425249

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1083425246 1083425249
Species Human (GRCh38) Human (GRCh38)
Location 11:62580989-62581011 11:62581015-62581037
Sequence CCTATTATCTGCATTGTAGATGA ACTAAGACATGGAGAGCTAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 185} {0: 1, 1: 0, 2: 1, 3: 10, 4: 210}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!