ID: 1083434695_1083434705

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1083434695 1083434705
Species Human (GRCh38) Human (GRCh38)
Location 11:62634336-62634358 11:62634373-62634395
Sequence CCATATGCTACCAAGCGTGAGAT AAACTGGGGCAGGAGGAGATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 38} {0: 1, 1: 0, 2: 4, 3: 47, 4: 518}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!