ID: 1083457135_1083457146

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1083457135 1083457146
Species Human (GRCh38) Human (GRCh38)
Location 11:62786814-62786836 11:62786834-62786856
Sequence CCCACGGCTCCGCGGCCGCCCGG CGGGGACAAGAAGGAGCCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 282} {0: 1, 1: 0, 2: 2, 3: 16, 4: 265}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!