ID: 1083457135_1083457147

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1083457135 1083457147
Species Human (GRCh38) Human (GRCh38)
Location 11:62786814-62786836 11:62786843-62786865
Sequence CCCACGGCTCCGCGGCCGCCCGG GAAGGAGCCGGCGGCAGCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 282} {0: 1, 1: 0, 2: 2, 3: 55, 4: 515}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!