ID: 1083526595_1083526601

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1083526595 1083526601
Species Human (GRCh38) Human (GRCh38)
Location 11:63372065-63372087 11:63372112-63372134
Sequence CCTCTGTGATACTGTCCTGGGAA GATCACAGGGTGGTAAAAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 178} {0: 1, 1: 0, 2: 3, 3: 11, 4: 191}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!