ID: 1083528935_1083528945

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1083528935 1083528945
Species Human (GRCh38) Human (GRCh38)
Location 11:63398627-63398649 11:63398673-63398695
Sequence CCCACAATCACTGTGCTCTCTAT TGCACCAGGCAGCCACTGCTGGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 44, 3: 105, 4: 331} {0: 1, 1: 1, 2: 14, 3: 68, 4: 318}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!