|
Left Crispr |
Right Crispr |
| Crispr ID |
1083528935 |
1083528947 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:63398627-63398649
|
11:63398679-63398701
|
| Sequence |
CCCACAATCACTGTGCTCTCTAT |
AGGCAGCCACTGCTGGGAGATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 3, 2: 44, 3: 105, 4: 331} |
{0: 1, 1: 1, 2: 10, 3: 63, 4: 542} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|