ID: 1083541941_1083541949

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1083541941 1083541949
Species Human (GRCh38) Human (GRCh38)
Location 11:63517624-63517646 11:63517660-63517682
Sequence CCTCCCAACTAAAATTTATATGT CCCAAGGAAATGGTGTTTGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 8, 3: 132, 4: 768}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!