ID: 1083544534_1083544545

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1083544534 1083544545
Species Human (GRCh38) Human (GRCh38)
Location 11:63538619-63538641 11:63538650-63538672
Sequence CCTCCAGTCATGAGGCTGCTATG CAGGACATGGAGAAGTGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 9, 4: 126} {0: 1, 1: 0, 2: 2, 3: 46, 4: 500}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!